Library

Protein Synthesis and Mutations

By Shoshana Berkovic
Last updated over 6 years ago
6 Questions
Note from the author:
students will transcribe a DNA sequence of 30 nitrogen bases to an RNA sequence of codons, use a genetic code chart to translate the codons to an amino acid sequence, then record the effects of a substitution and a deletion mutation on that original DNA sequence.
1.

Write the sequence of RNA bases that would be transcribed from the sequence of 30 bases below:
TACACGCAATTACCAGGGTAGCCATTGATT
Use the space bar to separate your sequence into codons.

2.

Use the genetic code chart provided above to translate your sequence of RNA base codons into an amino acid sequence to make a protein. Copy the three letters representing each amino acid as shown on the chart. Separate each of your amino acids from the others with a space.

3.

Explain what would happen if there was a substitution mutation that changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. Don't forget to separate each codon with a space.

4.

Write the sequence of amino acids that would result from this kind of mutation.

5.

Let's say that there is a deletion mutation that caused that same base in the DNA (the C in the 5th place from the beginning) to be missing from the DNA sequence?
Write the sequence of RNA codons that would result from this kind of mutation.

6.

Write the sequence of amino acids based on the RNA codons you wrote in #5 that would result from this deletion mutation. (Compare your sequence to the sequence you wrote for #2 - think about how that one missing base affected the protein)