DNA Part 1 Concept Review
starstarstarstarstarstarstarstarstarstar
by John Lundy
| 16 Questions
Note from the author:
A Review assignment dedicated to the structure of
Functionalized Placeholder
1
2
3
4
5
6
7
8
9
1
10
What do the Letters DNA stand for?
2
10
Rosalind Franklin
James Watson
Maurice Wilkins
Francis Crick
3
10
Amino Acid
Nucleotide
Carbohydrate
Lipid
4
10
Posphate Group
Nitroganouse Base
5 Carbon sugar
Hydrogen Bond
5
10
Adenine
Thymine
Uricil
Cytosine
Guanine
Metheonine
6
10
1
2
3
4
7
10
1
2
3
4
8
10
Adenine
Thymine
Uricil
Cytosine
Guanine
Metheonine
9
10
Adenine
Thymine
Uricil
Cytosine
Guanine
Metheonine
Functionalized Placeholder
10
11
12
13
14
15
10
10
Which bases pair in equal amounts?
A-T
G-T
C-G
A-C
11
10
Peptide Bonds
Hydrogen Bonds
Ionic Bonds
Amine Bonds
12
10
13
10
Alpha Coil
Bata Pleeteed Sheet
Alpha Helix
Double Helix
14
10
15
10
AATTCGCGGTATTAGACGTT
Add to my formatives list

Formative uses cookies to allow us to better understand how the site is used. By continuing to use this site, you consent to the Terms of Service and Privacy Policy.