DNA Part 1 Concept Review
starstarstarstarstarstarstarstarstarstar
by John Lundy
| 16 Questions
Note from the author:
A Review assignment dedicated to the structure of
The outlined content above was added from outside of Formative.
Functionalized Placeholder
1
2
3
4
5
6
7
8
9
1
10 pts
What do the Letters DNA stand for?
2
10 pts
Rosalind Franklin
James Watson
Maurice Wilkins
Francis Crick
3
10 pts
Amino Acid
Nucleotide
Carbohydrate
Lipid
4
10 pts
Posphate Group
Nitroganouse Base
5 Carbon sugar
Hydrogen Bond
5
10 pts
Adenine
Thymine
Uricil
Cytosine
Guanine
Metheonine
6
10 pts
1
2
3
4
7
10 pts
1
2
3
4
8
10 pts
Adenine
Thymine
Uricil
Cytosine
Guanine
Metheonine
9
10 pts
Adenine
Thymine
Uricil
Cytosine
Guanine
Metheonine
Functionalized Placeholder
10
11
12
13
14
15
10
10 pts
Which bases pair in equal amounts?
A-T
G-T
C-G
A-C
11
10 pts
Peptide Bonds
Hydrogen Bonds
Ionic Bonds
Amine Bonds
12
10 pts
13
10 pts
Alpha Coil
Bata Pleeteed Sheet
Alpha Helix
Double Helix
14
10 pts
15
10 pts
AATTCGCGGTATTAGACGTT
Add to my formatives list

Formative uses cookies to allow us to better understand how the site is used. By continuing to use this site, you consent to the Terms of Service and Privacy Policy.